Protocol to Genotype Rs1 Mice:
Note: DNA Extraction Method and PCR Reaction Mix of Sigma Aldrich as well as Protocol are being use for genotyping. Product Code XNAT- 1KT. For detailed Technical Bulletin go to sigma-aldrich.com.
Primers:
ECH009
TetORs1 F-1244: GCCCATCAGATCCAGATGTT
ECH004
TetORs1 R-1926: GGGTCCATGGTGATACAAGG
PCR product: 683 bp.
Reagents Needed (Provided in Sigma Kit)
For Tail Digest:
Extraction Solution Product Code E7526
Tissue Prep Solution Product Code T3073
Neutralization Solution B Prod. Code N3910
For PCR Reaction:
REDExtract-N-Amp PCR reaction Mix Product Code R4775
Procedure:
For DNA Extraction from tail tips:
1. Mix 50ul of Extraction Solution and 12.5ul of tissue prep solution Note: If several reactions will be done, a master mix of extract solution and tissue prep may be done in.
2. Add the previously cut 0.5 to 1 cm. Mouse tail tip to the solution.
3. Incubate sample at room temperature for 10 min.
4. Incubate sample at 95 C for 3 min.
5. Add 50ul of Neutralization solution B to sample and mix by vortexing.
6. Store the neutralized tissue extract at 4 C or use immediately in PCR.
PCR amplification
1. Add the following reagents to a PCR tube:
Water (DI, or PCR grade) 5.2 ul
RedExtract-N-Amp PCR mix 10.0 ul
Forward Primer 0.4 ul. (25 uM)
Reverse Primer 0.4 ul (25 uM)
Tissue extract 4.0 ul
Total volume 20.0 ul
2. Mix all reagents gently.
3. Perform PCR in the following conditions: (program ED002)
1. 94 C for 5:00
2. 94 C for 1:00
3. 58 C for 2:00
4. 72 C for 2:00
5. Go to 2, 34 times
6. 72 C for 15:00
7. 15 C for ever
8. End
4. Analyze Product on a 2% agarose gel. Note: all 20ul of product may be loaded directly to gel, no need to use a separate loading buffer.
Note: 1. Now using half the amount of Tail Digest reagents (to save reagents). It used to be 100ul for Extract sol, and 25ul of Tissue prep. Results have proven to be as effective.
2. Sigma Kit Protocol initially used only for Rs1/Col1 genotype. However, was proven as a better PCR kit and method. It saves time as well as it is cost effective. Now using the kit for every Conklin lab mouse strain genotype. See Cost Analysis comparison.