Protocol to Genotype ColI(2.3)-tTA Mice: R. 20080528


Note: DNA Extraction Method and PCR Reaction Mix of Sigma Aldrich as well as Protocol are being use for genotyping. Product Code XNAT- 1KT. For detailed Technical Bulletin go to: http://www.sigma-aldrich.com

Primers:

ECH048 GTCGTAATAATGGCGGCATA 3' tTA
ECH049 CCAGCCACACTCCAGTGA 5' 2.3 alpha Col

PCR product: 960 bp

Reagents Needed (Provided in Sigma Kit)

For Tail Digest:


Extraction Solution Product Code E7526
Tissue Prep Solution Product Code T3073
Neutralization Solution B Prod. Code N3910

For PCR Reaction:


REDExtract-N-Amp PCR reaction Mix Product Code R4775

Procedure:

For DNA Extraction from tail tips:

1. Mix 50ul of Extraction Solution and 12.5ul of tissue prep Solution Note: If several reactions will be done, a master mix of extract solution and tissue prep may be.
2. Add the previously cut 0.5 to 1 cm. Mouse tail tip to the solution.
3. Incubate sample at room temperature for 10 min.
4. Incubate sample at 95 C for 3 min.
5. Add 50ul of Neutralization solution B to sample and mix by vortexing.
6. Store the neutralized tissue extract at 4 C or use immediately in PCR.

PCR amplification


1. Add the following reagents to a PCR tube:

Water (DI, or PCR grade) 5.2 ul
RedExtract-N-Amp PCR mix 10.0 ul.
Forward Primer 0.4 ul. (25 uM)
Reverse Primer 0.4 ul (25 uM)
Tissue extract 4.0 ul.

Total volume 20.0 ul.


2. Mix all reagents gently.

3. Perform PCR in the following conditions: (program EDColI)

1. 94 C for 5:00
2. 94 C for 0:45
3. 65 C for 1:00
4. 72 C for 1:30
5. Go to 2, 14 times
6. 94 C for 0:45
7. 58 C for 1:00
8. 72 C for 1:30
9. Go to #6 19 times
10. 72 C for 15:00
11. 15 C for ever
12. End

4. Analyze Product on a 2% agarose gel. Note: all 20ul of product may be loaded directly to gel, no need to use a separate loading buffer.

Note:

Now using half the amount of Tail Digest reagents (to save reagents). It used to be 100ul for Extract sol, and 25ul of Tissue prep. Results have proven to be as effective.

Topic revision: r2 - 03 Sep 2008 - 10:41:03 - BenPhillips
 

This site is powered by the TWiki collaboration platformCopyright © by the contributing authors. All material on this collaboration platform is the property of the contributing authors.
Ideas, requests, problems regarding TWiki? Send feedback